rs251614 chr5:65932423 G>C
- Sequence
aggcattgcctttgttcttgtaaa[G/C]gtgttagctgttgcaaccattgct
- ASB in cell types
- SUM159PT (Triple negative breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (Triple negative breast cancer) | 0.22 | 1.64 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 14-item case/control for disordered eating behaviors, major depressive disorder (broad definition) (males), schizophrenia