rs252244 chr16:29228697 A>G
- Sequence
gggtgagatgcgtgatagaaggac[A/G]tatcccacatcacgtgcactgaag
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines) HCT-116 (colon carcinoma) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN RAD21_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.10 | 3.58 | 1.00 | n/a | n/a | |||
| RAD21_HUMAN | -4.05 | 3.03 | 1.33 | n/a | n/a | |||
| CTCF_HUMAN | -0.17 | 2.48 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood