rs252780 chr5:78057301 G>A
- Sequence
cactgttcctctcattttagttta[G/A]tccactaggagacagcagtggacc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines) bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.33 | -0.01 | 1.36 | -1.10 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
