rs252803 chr5:107428231 A>G
- Sequence
agtgcatctcgattttgatgcagc[A/G]tcttttccatactgagaaaacaac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | -2.17 | 2.52 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, diabetic retinopathy in type 2 diabetes mellitus, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), recurrent early onset major depressive disorder (males)