rs252965 chr5:161295856 G>T
- Sequence
cttagaggaaacactaaacaaata[G/T]attattaaaatgagttgtgaaagt
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.88 | -0.48 | 2.00 | -0.79 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, autism, cognitive response to topiramate treatment as measured by the controlled oral word association cognitive test, college completion, rheumatoid arthritis, serum creatinine, systolic blood pressure (sbp), years of education