rs254452 chr5:181207747 C>T
- Sequence
aatgaaaaattgttgagatacggt[C/T]atcgggcgcccggctagctcagtc
- ASB in cell types
- PC3(bone mets prostate adenocarcinoma) CD34+ hematopoietic stem cells-derived proerythroblasts MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC3(bone mets prostate adenocarcinoma) | -0.04 | 1.19 | 1.83 | |||
| CD34+ hematopoietic stem cells-derived proerythroblasts | 1.90 | -0.87 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.27 | 1.24 | 3.05 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Uterus, Vagina