rs25850 chr16:2214852 G>C
- Sequence
ccgcggcgccctccccgcccccgg[G/C]gcgctcattggcccagcgcctcgc
- ASB in cell types
- K562 (myelogenous leukemia) BJ1-hTERT (Human fibroblast telomerase immortalized cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.24 | 0.80 | 2.02 | |||
| BJ1-hTERT (Human fibroblast telomerase immortalized cell line) | 1.50 | -0.84 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid