rs258807 chr5:143155638 G>T
- Sequence
gatctctacagcctgtcagcagag[G/T]gggtatgggaggaggtaagggcag
- ASB in cell types
- LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES (lund human mesencephalic cells) | 2.06 | n/a | 1.00 |
Items per page:
1 – 1 of 1