rs258874 chr5:173618958 A>G
- Sequence
atccatgaccttccctctgcaatc[A/G]aagtaaatgatgagggataaaagg
- ASB in cell types
- K562 (myelogenous leukemia) neutrophils from periferal blood pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.10 | 0.73 | 1.99 | |||
| neutrophils from periferal blood | 0.29 | 2.50 | 1.50 | |||
| pancreas | -0.81 | 1.01 | 1.11 |
Items per page:
1 – 3 of 3