rs26106 chr5:14458638 T>C
- Sequence
gcttggctccaagtcacagcacag[T/C]aagtgactctgaaatctgccacct
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.91 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), asthma, comorbid depressive syndrome and alcohol dependence, cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol, neuroblastoma (brain cancer), total cholesterol