rs261342 chr15:58438954 G>C
- Sequence
ggggaaaaagtgaagagaagagaa[G/C]gaaatgcatggaatgcaagcggag
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.60 | -1.42 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.04 | 0.03 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.87 | 1.61 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
EMBL-EBI high density lipoprotein cholesterol levels, metabolite levels, total cholesterol levels, triglycerides
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), apoa1 (apolipoprotein ai), hdl cholesterol, hdl cholesterol change with statins, microalbuminuria, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio