rs261857 chr1:240936822 G>T
- Sequence
agatacagtaagttcctcttgaaa[G/T]atttaatttctgacttccttgttc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.98 | 0.13 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP eye color, hdl cholesterol, schizophrenia, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, stabilized warfarin dose