rs262556 chr19:4872571 G>A
- Sequence
tcccaagtagctgggactacaggc[G/A]cccgccaccaagcccggctaattt
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte K562 (myelogenous leukemia) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.11 | 0.62 | 2.00 | |||
| foreskin keratinocyte | n/a | 1.60 | 2.83 | |||
| K562 (myelogenous leukemia) | -0.15 | 0.77 | 2.00 | |||
| epithelial cell of prostate | 1.27 | -1.27 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.81 | 0.09 | 1.11 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial