rs262670 chr1:2151019 C>T
- Sequence
atggggcccgggggcccgggaacg[C/T]gctgccctggggcctcctccgggc
- ASB in cell types
- NOMO-1 (acute monocytic leukemia)
- ASB for transcription factors
- ZF64B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZF64B_HUMAN | 1.80 | -4.07 | 1.83 | 5.72 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood