rs26302 chr12:27969169 C>G
- Sequence
gaaacgctccctcttatggaaaca[C/G]acataaagtctctctcttgcctgt
- ASB in cell types
- foreskin keratinocyte glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.03 | 0.04 | 1.67 | |||
| glioblastoma cells | 2.22 | -0.22 | 1.33 |
Items per page:
1 – 2 of 2