rs263478 chr1:86742189 G>T
- Sequence
tagtcacttggaaataaataattc[G/T]ctgctttcttttcaacagttttcc
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.36 | 0.26 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg