rs264590 chr2:159118641 G>A
- Sequence
atatagactgttagccatatgtgt[G/A]ttacctgaaaccttaaggagaaag
- ASB in cell types
- HeLa (cervical adenocarcinoma) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | 1.68 | -0.37 | 2.00 | |||
| SK-N-SH (neuroblastoma) | 0.93 | -0.09 | 1.14 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, height, hypertension (early onset hypertension), microalbuminuria, tetrology of fallot