rs266387 chr15:66946947 G>A
- Sequence
caaacgttctcccaaagctagagc[G/A]aaggccctttcactttttgttacc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -0.06 | 0.44 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 1.59 | -5.44 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, multiple sclerosis severity scale, spine bone mineral density (bmd), total cholesterol