rs266720 chr3:186783713 C>A
- Sequence
caggggagatgatagtggatggca[C/A]ggaggcaaaaactctaaattaatg
- ASB in cell types
- neural cell GM12878 (female B-cells lymphoblastoid cell line) thoracic aorta BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- TYY1_HUMAN RFOX2_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -0.52 | 4.54 | 1.25 | n/a | No Hit | |||
| RFOX2_HUMAN | 1.70 | -1.64 | 1.00 | n/a | n/a | |||
| GCR_HUMAN | 0.19 | 0.66 | 1.15 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid