rs266857 chr19:50836461 T>G
- Sequence
ccgagtcccaactcattgctctat[T/G]tccccaaaccctccttccctgttc
- ASB in cell types
- K562 (myelogenous leukemia) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.13 | 0.92 | 2.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -2.00 | 2.37 | 1.00 |
Items per page:
1 – 2 of 2