rs267568 chr3:37532201 C>A
- Sequence
ctggaagtcccgcagttccactgc[C/A]tctgttatcactactctctgttga
- ASB in cell types
- definitive endoderm from HUES8
- ASB for transcription factors
- GATA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 1.60 | 0.36 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Skin_Sun_Exposed_Lower_leg, Whole_Blood