rs268739 chr5:33300208 C>T
- Sequence
catattctgatcgttttctatagg[C/T]aatgaaaggcataatctttctttc
- ASB in cell types
- macrophages form periferal blood GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 1.42 | -0.47 | 2.00 | |||
| GM23338 | 1.95 | -1.88 | 1.17 |
Items per page:
1 – 2 of 2