rs269767 chr5:140157337 A>G
- Sequence
ggacctaatagacgatgccgcagc[A/G]gcccagcctccagcgtctggggta
- ASB in cell types
- foreskin keratinocyte CTV-1 (Adult T acute lymphoblastic leukemia) THP-1 (acute monocytic leukemia) spleen
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.82 | 2.67 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.33 | 1.05 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.69 | 0.79 | 1.04 | |||
| spleen | 0.52 | 0.86 | 1.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.46 | -0.49 | 1.00 |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis