rs270211 chr5:5139437 C>G
- Sequence
atccagctacagcagaattctggc[C/G]aggctgttgaccgcacacctgctg
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- KDM2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM2B_HUMAN | 2.32 | -4.12 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1