rs270514 chr1:234458521 T>C
- Sequence
gttttgtaaatagtttttttggaa[T/C]atagccaacgcctgtttatttagt
- ASB in cell types
- liver primary prostate cancer
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 0.33 | 1.39 | 1.00 | |||
| primary prostate cancer | -0.30 | 2.32 | 2.00 |
Items per page:
1 – 2 of 2