rs270708 chr1:44584032 A>C
- Sequence
tctcacatcattctcacagctaca[A/C]catgaggtacatagcatcgtgtct
- ASB in cell types
- CRC107 (colorectal cancer metastatic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CRC107 (colorectal cancer metastatic stem cells) | 1.85 | -0.25 | 1.00 |
Items per page:
1 – 1 of 1