rs271760 chr1:234544911 C>T
- Sequence
ttcgggagatgactgatgaacccc[C/T]attcctcctgccttcccaggtggc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZSCA4_HUMAN ZN366_HUMAN ZEB1_HUMAN PRDM4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZSCA4_HUMAN | 1.89 | n/a | 4.00 | n/a | No Hit | |||
| ZN366_HUMAN | 1.49 | n/a | 3.00 | n/a | n/a | |||
| ZEB1_HUMAN | 2.72 | n/a | 3.00 | n/a | No Hit | |||
| PRDM4_HUMAN | 3.03 | -5.54 | 2.00 | n/a | No Hit | |||
| ZN398_HUMAN | 1.35 | n/a | 4.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP birth weight, fasting blood glucose, hip bone mineral density (bmd), homa-b, ldl cholesterol, schizophrenia, total cholesterol, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid