rs273122 chr7:41445518 A>G
- Sequence
gctaaaccatcacagtaaaaaaca[A/G]cacctaaatgactaaaggcacaaa
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- FEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FEZF1_HUMAN | n/a | 2.58 | 1.50 | 1.23 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, college completion, hdl cholesterol, infant head circumference, waist hip ratio