rs2731614 chr12:19846754 T>C
- Sequence
ccttactaaagataaaatggaatg[T/C]ggaggttggttgctcaagaatgaa
- ASB in cell types
- HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | 1.38 | -0.14 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diastolic blood pressure (dbp), refractive error, systolic blood pressure (sbp)