rs2731708 chr5:172361532 C>T
- Sequence
tcacccaagcttcctgacttcctg[C/T]aagctgggggcccagggcagtggg
- ASB in cell types
- hTERT-HME1(Telomerase immortalized cell line) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- BRCA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRCA2_HUMAN | -1.39 | 1.91 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1