rs2732318 chr8:33473170 A>G
- Sequence
cccgaagagccgatcaggagcgga[A/G]gaggcggccgcgcgggcgagctcg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) TTC-1240 (Rhabdoid tumor of the kidney) CD14+ monocytes
- ASB for transcription factors
- TYY1_HUMAN STAT1_HUMAN SPI1_HUMAN GABP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 3.05 | -0.15 | 1.12 | n/a | No Hit | |||
| STAT1_HUMAN | 1.25 | -0.50 | 1.67 | n/a | No Hit | |||
| SPI1_HUMAN | 1.55 | -0.10 | 2.07 | -4.78 | Concordant | |||
| GABP1_HUMAN | 1.66 | -2.70 | 1.50 | n/a | n/a | |||
| NFAC3_HUMAN | 2.63 | -2.42 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood