rs2733357 chr17:5618665 C>A
- Sequence
agcataatgcttttgagattcatt[C/A]atggtgtgcatacactgtgcatgt
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | -0.13 | 1.44 | 1.00 | |||
| LNCaP (prostate carcinoma) | 0.84 | -0.22 | 1.41 |
Items per page:
1 – 2 of 2