rs2735593 chr1:85276655 G>C
- Sequence
caccgccccacggcgaggcgcgtc[G/C]cttagcagagcccgccctgtctct
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -1.46 | 2.30 | 3.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, microalbuminuria, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Vagina