rs2736000 chr8:126387742 C>A
- Sequence
gtcctgtttttagtatactgattg[C/A]cttagggattctagaagcccatgg
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | -3.47 | 3.86 | 1.00 | 0.15 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, gender differentiated, diastolic blood pressure (dbp), ldl cholesterol, mitral annular calcium, parkinsons disease (pd), paternal transmission distortion, prop taste detection threshold, systolic blood pressure (sbp), transmission distortion, triglycerides change with statins