rs2736189 chr6:31596951 G>A
- Sequence
tgagcacaggctattggaaaagtg[G/A]cacctacagacttgctcaacacag
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.01 | 1.01 | 1.10 | 0.03 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP chronic kidney disease, cystatin c in serum, height, information processing speed (symbol search), ldl cholesterol, prop taste detection threshold, rheumatoid arthritis, rheumatoid arthritis (acpa-positive), total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood