rs2736360 chr8:11515958 G>A
- Sequence
tttgggaggcttttgtatcctggt[G/A]tggggatgggtgtgcactcgcgtg
- ASB in cell types
- GM23248
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | -2.13 | 2.27 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, diastolic blood pressure (dbp), hypertension (early onset hypertension), kawasaki disease, kawasaki disease (excluding controls with chronic hepatitis b, drug eruption and tuberculosis), neuroblastoma (brain cancer), parkinsons disease, systolic blood pressure (sbp)
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid