rs2736990 chr4:89757390 G>A
- Sequence
ccttatgagctgtttaggaagaag[G/A]tgtatatgtgtgtaacagggagca
- ASB in cell types
- VCaP (prostate carcinoma)
- ASB for transcription factors
- GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | 2.41 | -1.65 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, fasting insulin, hepatitis b virus (hbv)-related hepatocellular carcinoma, late onset alzheimers disease, parkinsons disease, parkinsons disease (pd), sporadic creutzfeldt-jakob disease
PheWAS abdominal hernia, abnormal weight gain, acid-base balance disorder, acute reaction to stress, adverse effects of cardiac rhythm regulators, allergic conjunctivitis, althetes foot, arthralgia/ankylosis of temporomandibular joint, arthropathy nos involving multiple sites, atrophy of edentulous alveolar ridge, benign neoplasm of respiratory and intrathoracic organs, benign neoplasm of uterus, bone cancer, breast cancer, breast cancer, including in situ, cancer of bone & connective tissue, cancer of larynx, cancer of other lymphoid, histiocytic tissue, cancer of the upper aerodigestive tract, cerebral atherosclerosis, chronic prostatitis, chronic renal failure, cornea replaced by transplant, cyst of kidney, acquired, degeneration of intervertebral disc, disorders of menstruation, disorders of the globe, diverticulosis, diverticulum of esophagus, acquired, dyspareunia, hyperosmolality and/or hypernatremia, hyperpotassemia, hypotension, infections of kidney, injuries to the nervous system, irregular menstrual cycle/bleeding, jaw disease nos, lesions of stomach and duodenum, liver replaced by transplant, localized adiposity, mastodynia, methicillin resistant staphylococcus aureus, multiple sclerosis, muscular dystrophies and other myopathies, neoplasm of uncertain behavior, non-hodgkins lymphoma, nonrheumatic tricuspid valve disorders, orthostatic hypotension, osteoporosis, osteoporosis, nos or other, other aneurysm, other cardiac conduction disorders, other disorders of stomach and duodenum, other disorders of the kidney and ureters, other disorders of the nervous system, peripheral or central vertigo, prolapse of vaginal vault after hysterectomy, pulmonary embolism and infarction, renal failure, reticulosarcoma, rosacea, salicylates causing adverse effects in therapeutic use, skin neoplasm of uncertain behavior, spasm of muscle, syncope and collapse, thrombocytopenia, traumatic arthropathy, umbilical hernia, unspecified erythematous condition, uterine cancer, vascular dementia, viral enteritis