rs2737247 chr8:115648138 A>G
- Sequence
ggaagcaaaagagaagacaagagg[A/G]aagagagtttatggagagaggaag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) macrophages form periferal blood
- ASB for transcription factors
- P66B_HUMAN PAX8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P66B_HUMAN | 2.20 | -1.20 | 1.00 | n/a | n/a | |||
| PAX8_HUMAN | 2.90 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting insulin, hdl cholesterol change with statins, homa-b, homa-ir, ldl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol, triglycerides, type 2 diabetes