rs2738116 chr8:6928895 A>G
- Sequence
attagttcagggggcacagaatac[A/G]ctgctgctggttccgtgtcagcgg
- ASB in cell types
- foreskin keratinocyte KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.11 | -0.13 | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | 1.73 | -0.64 | 2.00 |
Items per page:
1 – 2 of 2