rs2738456 chr19:11126128 T>C
- Sequence
caagagtgaaactccattcccctc[T/C]gcaaagaaaaggaatattatcaga
- ASB in cell types
- LNCaP (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line) KMS-11 (Plasma cell myeloma) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.15 | -0.75 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.11 | 0.39 | 1.07 | |||
| KMS-11 (Plasma cell myeloma) | 0.77 | 2.10 | 2.00 | |||
| neutrophils | -0.71 | 1.66 | 1.50 |
Items per page:
1 – 4 of 4