rs273969 chr7:137903623 A>G
- Sequence
tgattaagtagcactgctcctttc[A/G]gctaaaacagggcttctcctgcta
- ASB in cell types
- neural progenitors A549 (lung carcinoma) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | 2.49 | -2.10 | 1.00 | |||
| A549 (lung carcinoma) | -0.06 | 0.77 | 2.00 | |||
| GBM39 (Human brain tumor) | -0.06 | 1.63 | 2.00 |
Items per page:
1 – 3 of 3