rs274007 chr7:137961965 C>A
- Sequence
gttcttctaggaactcacactgct[C/A]ccctgtgtctccatgaacccagcc
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.44 | 0.91 | 1.52 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, fasting blood glucose, height, homa-b, refractive error, serum creatinine, triglycerides, triglycerides change with statins