rs2740471 chr12:7934336 C>G
- Sequence
taccccagactccacggaagccca[C/G]tggtggtggtggagggggtggtag
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 2.07 | -1.22 | 1.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood