rs2741194 chr8:133050086 G>A
- Sequence
tcagatttaacccaggacagtttg[G/A]aacattcctcttttaagatctgtc
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.12 | 2.24 | 1.60 | 0.23 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP acute lung injury following major trauma, birth weight, infant head circumference, ldl cholesterol, obesity with early age of onset (age >2)