rs2745309 chr1:18584853 G>A
- Sequence
tgatccactgggggtagggggtgt[G/A]gcaagagcaatgtggaaaggttgt
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.79 | n/a | 2.50 | |||
| K562 (myelogenous leukemia) | 0.82 | 0.41 | 1.15 |
Items per page:
1 – 2 of 2