rs2745367 chr6:56247545 C>G
- Sequence
cggagtccgttctccctgcagcgg[C/G]cagtgcagagctcagaggctcaga
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) PANC1 (pancreatic ductal adenocarcinoma) tibial nerve
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.11 | 1.53 | 1.17 | 2.95 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
