rs2745421 chr6:132676005 C>T
- Sequence
gcaaagatgattagtgccacaggg[C/T]atgaagcagagtcttgcaacactt
- ASB in cell types
- THP-1 (acute monocytic leukemia) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.27 | 1.60 | 1.80 | |||
| MDM(monocyte derived macrophages) | 0.48 | 2.82 | 2.07 |
Items per page:
1 – 2 of 2