rs2745731 chr20:46577252 A>C
- Sequence
caacctacaggtgtatgcagccca[A/C]agatgtatcagtccacaagtgtat
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | n/a | 2.17 | 2.00 | 3.27 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, infant head circumference, ldl cholesterol change with statins, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg