rs2748432 chr10:133125086 G>A
- Sequence
actttgccgggcatccgtgtagcc[G/A]ctgtagctctcttaatctcacagt
- ASB in cell types
- adrenal gland MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | -2.17 | 2.52 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -3.73 | 2.12 | 1.50 |
Items per page:
1 – 2 of 2