rs2753916 chr6:24360002 C>A
- Sequence
ggagaggggaggggagctcgggcg[C/A]cggccgcgcgggggcggggcggtg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) GM12890 (Lymphoblastoid Cell Lines) iPS-derived dermal fibroblasts
- ASB for transcription factors
- RFX1_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | 1.11 | -1.16 | 1.17 | n/a | No Hit | |||
| JUN_HUMAN | 1.34 | -0.03 | 1.14 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid